gapdh (Cell Signaling Technology Inc)
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 
99
Structured Review
Cell Signaling Technology Inc
gapdh
Gapdh, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 11397 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+rabbit+mab+antibody/GAPDH+XP+Rabbit+mAb/pmc13049640-314-4-5
Average 99 stars, based on 11397 article reviews
Gapdh, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 11397 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+rabbit+mab+antibody/GAPDH+XP+Rabbit+mAb/pmc13049640-314-4-5
Average 99 stars, based on 11397 article reviews
gapdh - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
other:Article Title: A comprehensive protocol for efficient differentiation of human NPCs into electrically competent neurons. Article Snippet: Total protein extracts were loaded on an 8% SDS-page gel and immunodecoration was performed with primary antibodies used as follow: GAPDH (5174) rabbit mAb 1:8000 (RRID:AB_10622025; Article Title: Interferon-γ induces combined pyroptotic angiopathy and APOL1 expression in human kidney disease. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Liu et al. scRNAseq NIH GEO database GEO: GSE135663 Organoid scRNAseq NIH GEO database GEO: GSE230848 NEPTUNE bulk RNAseq NIH GEO database GEO: GSE219185 NEPTUNE snRNAseq NIH GEO database GEO: GSE213030 Experimental models: Cell lines WTC11 iPSCs derived from a Japanese male donor Coriell GM25256 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E8 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E9 GFP-Tubulin Allen Institute/Coriell AICS-0012 1016SevA iPSCs derived from fibroblasts from a non-African ancestry donor Harvard Stem Cell Institute N/A UM77-2 hESCs J Harder Lab, University of Michigan NIH registration no. 0278 iPSC line BXS0114 (African American Female) ATCC ACS-1028 iPSC line BYS0110 (African American Male) ATCC ACS-1024 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC35 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC36 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC37 HUVECs #1 (pooled donors, Lot #0000478982) Lonza CC-2519 HUVECs #2 (pooled donors, Lot #3001900190) Lonza CC-2519 HUVECs #3 (pooled donors, Lot #0000474578) Lonza CC-2519 Oligonucleotides CCACCGGCAGACCGGACTAG IDT HF22 Recombinant DNA pGuide (modified for oligo HF22) Addgene 64711 pCas9_GFP Addgene 44719 Software and algorithms ImageJ 1.54f NIH N/A R Software (R Core Team [2023]) N/A Seurat v4.0 N/A CZ CELLxGENE Chan Zuckerberg Initiative N/A Ingenuity Pathway Analysis (IPA) Qiagen N/A Control:Article Title: ChIP-seq Profiling Identifies Histone Deacetylase 2 Targeting Genes Involved in Immune and Inflammatory Regulation Induced by Calcitonin Gene-Related Peptide in Microglial Cells Article Snippet: .. Article Title: Altered gene expression signatures by calcitonin gene-related peptide promoted mast cell activity in the colon of stress-induced visceral hyperalgesia mice. Article Snippet: Abbreviations: CGRP, calcitonin gene-related peptide; CRCP, receptor component protein; Crem, cAMP-responsive element modulator; CRLR, calcitonin receptor-like receptor; DEGs, differentially expressed genes; FosB, protein fosB; Gpr35, G-protein coupled receptor 35; IBS, irritable bowel syndrome; Il1r1, interleukin-1 receptor type 1; MafF, transcription factor MafF; MCs, mast cells; Nr4a3, nuclear receptor subfamily 4 group A3; RAMP1, receptor activity-modifying protein 1; RNA-Seq, RNA sequencing; RTCA, real-time cell analysis; Scrt1, transcriptional repressor scratch 1; Sphk1, sphingosine kinase 1; Tnfrsf1b, tumor necrosis factor (TNF) receptor superfamily member 1B; WAS, water-avoidance stress.. Department of Human Anatomy, Shandong First Medical University & Shandong Academy of Medical Sciences, Taian, China Article Title: ChIP-seq Profiling Identifies Histone Deacetylase 2 Targeting Genes Involved in Immune and Inflammatory Regulation Induced by Calcitonin Gene-Related Peptide in Microglial Cells. Article Snippet: .. |